NIH MBI Laboratory for Structural Genomics and Proteomics

Structures Solved
Year PDB Name Resolution Rfactor
Work FREE
2006 2B5O Ferredoxin-NADP reductase
2.5
0.184 0.235
2006 1ZYT Crystal structure of spin labeled T4 Lysozyme (A82R1)
1.7
0.187 0.206
2006 2CUU Crystal structure of spin labeled T4 Lysozyme (V131R1)
1.75
0.192 0.224
2006 2AW9 Superoxide dismutase with manganese from Deinococcus radiodurans
2.7
0.17 0.214
2006 2A4T Crystal structure of spin labeled T4 Lysozyme (V131R7)
1.7
0.181 0.215
2006 1ZR0 Crystal Structure of Kunitz Domain 1 of Tissue Factor Pathway Inhibitor-2 with Bovine Trypsin !
1.8
0.231 0.296
2006 2DPK The Crystal Structure of the Primary Ca2+ Sensor of the Na+/Ca2+ Exchanger
2.5
0.225 0.284
2006 2GM7 TenA Homolog/Thi-4 Thiaminase from Pyrobaculum Aerophilum
2.8
0.234 0.286
2006 2GM8 TenA Homolog/Thi-4 Thiaminase complexed with product 4-amino-5-hydroxymethyl-2-methylpyrimidine
2.5
0.189 0.237
2006 2G38 A PE/PPE Protein Complex from Mycobacterium tuberculosis
2.2
0.25 0.312
2006 2A7X Crystal Structure of A Pantothenate synthetase complexed with AMP
1.7
0.15 0.175
2006 2A84 Crystal structure of A Pantothenate synthetase complexed with ATP
1.55
0.152 0.169
2006 2A86 Crystal structure of A Pantothenate synthetase complexed with AMP and beta-alanine
1.85
0.161 0.195
2006 2A88 Crystal structure of A Pantothenate synthetase, apo enzyme in C2 space group
1.7
0.155 0.186
2006 2B5A C.BclI, Control Element of the BclI Restriction-Modification System
1.54
0.167 0.2
2006 2FGY Beta Carbonic Anhydrase from the Carboxysomal Shell of Halothiobacillus neapolitanus (CsoSCA)
2.2
0.171 0.217
2005 2APQ Crystal Structure of an Active Site Mutant of Bovine Pancreatic Ribonuclease A (H119A-RNase A) with a 10-Glutamine expansion in the C-terminal hinge-loop.
1.8
0.181 0.215
2005 2A18 Carboxysome shell protein ccmK4, crystal form 2
2.28
0.204 0.222
2005 2A1B Carboxysome shell protein ccmK2
2.9
0.313 0.346
2005 2A5X Crystal Structure of a Cross-linked Actin Dimer
2.49
0.197 0.25
2005 1NBU 7,8-Dihydroneopterin Aldolase Complexed with Product From Mycobacterium Tuberculosis
1.6
0.162 0.217
2005 1P7G superoxide dismutase from Pyrobaculum aerophilum
2005 1Y67 Crystal Structure of Manganese Superoxide Dismutase from Deinococcus radiodurans
1.85
0.184 0.205
2005 1YJO NNQQNY peptide from yeast prion Sup35 w/ Zn
1.3
0.11 0.154
2005 1YJP GNNQQNY peptide from yeast prion Sup35
1.8
0.181 0.19
2005 1YKW Novel RuBisCO-Like Protein from C. tepidum
2
0.201 0.245
2005 1Z8F Guanylate Kinase Double Mutant A58C, T157C from Mycobacterium tuberculosis (Rv1389)
2.5
0.181 0.236
2005 1Z9W Tetrameric structure of apo-7,8-Dihydroneopterin Aldolase from Mycobacterium tuberculosis
2.5
0.179 0.234
2005 1ZD1 NarLc withNULL74/-65 nonpalindromic promoter DNA
2.3
0.256 0.286
2005 1ZG5 NarLc withNULL89/-89 nonpalindromic promoter DNA
2.3
0.217 0.252
2005 1Z6K Citrate lyase beta subunit complexed with oxaloacetate and magnesium from M. tuberculosis
2.3
0.224 0.256
2004 1S3Q Ferritin with iron and magnesium (A. fulgidis)
2.1
0.18 0.24
2004 1S3Q Novel open pore ferritin APO form ( A.fulgidus)
2.1
0.179 0.217
2004 1S4Q guanylate kinase (M. tuberculosis)
2.16
0.177 0.231
2004 1S51 Bacteriorhodopsin mutant T24S
2
0.212 0.272
2004 1S52 Bacteriorhodopsin mutant T24V
2.3
0.199 0.266
2004 1S53 Bacteriorhodopsin mutant T46S
2
0.214 0.266
2004 1S54 Bacteriorhodopsin mutant T24A
2.2
0.231 0.287
2004 1S71 TruB (M. tuberculosis)
1.9
0.2 0.24
2004 1SGV tRNA PseudoUridine Synthase (M.Tuberculosis)
1.9
0.201 0.239
2004 1SIX dUTPase (Rv2697c) +dUMPNPP+ Mg2+ (M. tuberculosis)
1.3
0.12 0.138
2004 1SJN dUTPase (Rv2697c) +dUMPNPP+ Mg2+ (M. tuberculosis)
1.8
0.168 0.198
2004 1SK5 Ultra-high resolution structure d(CTTTTAAAAG)
0.89
0.126 0.145
2004 1SLH dUTPase (Rv2697c) +dUDP+ Mg2+ (M. tuberculosis)
3
0.224 0.265
2004 1SM8 dUTPase (Rv2697c) +dUTP + Cr3+(M. tuberculosis)
2.9
0.235 0.282
2004 1SMC dUTPase (Rv2697c) +dUTP (M. tuberculosis)
2.05
0.166 0.207
2004 1SNF dUTPase (Rv2697c) + dUMP + Mg2+ (M. tuberculosis)
1.85
0.169 0.204
2004 1SQ3 Novel open pore ferritin Fe form ( A.fulgidus)
2.7
0.177 0.217
2004 1SV0 Yan-SAM + Mae-SAM complex (D. melanogaster)
2.07
0.232 0.255
2004 1SV4 Yan-SAM domain (D. melanogaster)
2.15
0.22 0.251
2004 1SVD RuBisCO (Halothiobacillus neapolitanus)
1.8
0.146 0.168
2004 1TN0 Bacterorhodopsin A51P
2.5
0.173 0.262
2004 1TN5 Bacterorhodopsin K41P
2.2
0.249 0.299
2004 1U5H Citrate Lyase Beta Subunit ( M.Tuberculosis)
1.65
0.267 0.272
2004 1U5V Citrate Lyase Beta Subunit +ATP ( M.Tuberculosis)
1.85
0.212 0.234
2004 1XJI Bacteriorhodopsin crystallized in bicelles at room temperature
2.2
0.226 0.256
2003 1N2B Pantothenate synthetase –AMPCPP pantoate (M. tuberculosis)
1.7
0.184 0.215
2003 1N2I Pantothenate synthetase –pantoyl adenylate (M. tuberculosis) soaked
1.7
0.182 0.204
2003 1N2O Pantothenate synthetase –beta alanine (M. tuberculosis)
2.1
0.202 0.237
2003 1OY0 Ketopantoate Hydroxymethyltransferase
2.8
0.237 0.277
2003 1PJG r(CAAAGAAAAG) d(GTTTCTTTTC), Ca2+
1.1
0.127 0.158
2003 1PJO r(CAAAGAAAAG) d(GTTTCTTTTC), Mg2+
1.2
0.117 0.156
2003 1PK1 Hetero SAM domain structure of Ph and Scm
1.8
0.233 0.249
2003 1PK3 Scm SAM domain
1.85
0.216 0.231
2003 1PXR Structure of Pro50Ala mutant of Bacteriorhodopsin
1.7
0.207 0.245
2003 1PXS Structure of Met56Ala mutant of Bacteriorhodopsin
2.2
0.198 0.251
2003 1PY6 Bacteriorhodopsin crystallized from bicells
1.8
0.21 0.249
2003 1Q5I Bacteriorhodopsin mutant P186A
2.3
0.194 0.255
2003 1Q5J Bacteriorhodopsin mutant P91A
2.1
0.216 0.267
2003 1R7K FolB tetrameric (Rv3607c) (M. tuberculosis)
2.5
0.273 0.295
2003 1RH6 Xis insertion factor DNA comple
1.7
0.191 0.226
2003 1RII Phosphoglycerate mutase (Rv0489) (M. tuberculosis)
1.7
0.205 0.257
2003 1RKI Pag5_736
1.6
0.18 0.24
2002 1KME Bacteriorhodopsin Crystallized From Bicelles (H. salinarum)
2
0.263 0.275
2002 1KW4 Polyhomeotic Sam Domain Structure (D. melanogater)
1.75
0.22 0.234
2002 1L5X Survival protein E (SurE) homolog (P. aerophilum)
2
0.185 0.223
2002 1L6P Disulfide interchange protein, DsbD, N-termal domain (E. coli)
1.65
0.138 0.215
2002 1L9L Granulysin (human)
0.92
0.137 0.188
2002 1LKY Structure Of The Wild-Type Tel-Sam Polymer
2.3
0.232 0.283
2002 1LMI Secreted protein, Mpt63, Rv1926c (M. tuberculosis)
1.5
0.197 0.252
2002 1LNX SmAP1 heptamer in a new crystal form (P. aerophilum)
2.05
0.182 0.226
2002 1LOJ SmAP + uridine-5'-monophosphate (M. thermautotrophicum)
1.9
0.207 0.25
2002 1LU4 Disulfide oxido reductase, DsbE (M. tuberculosis) Rv2878c
1.1
0.143 0.203
2002 1M5Q SmAP (P. aerophilum)
2
0.191 0.236
2002 1M98 Crystal Structure Of Orange Carotenoid Protein (A. maxima)
2.1
0.218 0.275
2002 1MOP Pantothenate synthetase (M. tuberculosis)
1.6
0.192 0.211
2002 1MQ7 dUTPase (M. tuberculosis)
1.95
0.197 0.226
2002 1MY6 Fe-Superoxide dismutase (T. elongatus)
1.6
0.189 0.226
2002 1MZ4 Cytochrome c550 (T. elongatus)
1.8
0.182 0.202
2002 1N2E Pantothenate synthetase –AMPCPP pantoate (M. tuberculosis)
1.6
0.188 0.21
2002 1N2G Pantothenate synthetaseNULLAMPCPP (M. tuberculosis)
1.8
0.192 0.223
2002 1N2H Pantothenate synthetase –pantoyl adenylate (M. tuberculosis) cocrystallized
2
0.182 0.218
2002 1N2J Pantothenate synthetaseNULLpantoate (M. tuberculosis)
1.8
0.193 0.225
2001 1F18 Cu,Zn Superoxide dismutase, G85R mutant
1.8
0.197 0.234
2001 1F1A Cu,Zn Superoxide dismutase, H48Q mutant
1.8
0.2 0.239
2001 1F1C Cytochrome c549 (A. maxima)
2.3
0.217 0.26
2001 1F1D Cu,Zn Superoxide dismutase, H46C mutant
1.8
0.2
2001 1F1E Histone (M. kandleri)
1.3
0.163 0.208
2001 1F1F Cytochrome c6 (A. maxima)
2.3
0.232 0.255
2001 1F1G Cu,Zn Superoxide dismutase, nitric oxide
1.8
0.171
2001 1F1H Glutamine synthetase-ADP-thallium (S. typhimurium)
2.7
0.233 0.264
2001 1F1O Adenylosuccinate lyase (B. subtilis)
3.3
0.336 0.355
2001 1F52 Glutamine synthetase (S. typhimurium)
2.5
0.243 0.252
2001 1FK0 Maize lipid-transfer protein complex with capric acid
1.8
0.214 0.241
2001 1FK1 Maize lipid-transfer protein complex with lauric acid
1.8
0.182 0.194
2001 1FK2 Maize lipid-transfer protein complex with myristic acid
1.8
0.191 0.197
2001 1FK3 Maize lipid-transfer protein complex with palmitoleic acid
1.8
0.2 0.236
2001 1FK4 Maize lipid-transfer protein complex with stearic acid
1.8
0.208 0.2
2001 1FK5 Maize lipid-transfer protein complex with oleic acid
1.3
0.135 0.188
2001 1FK6 Maize lipid-transfer protein complex with a-linolenic acid
1.9
0.207 0.274
2001 1FK7 Maize lipid-transfer protein complex with ricinoleic acid
1.9
0.205 0.274
2001 1FPY Glutamine synthetase-ADP-phosphinothricin (S. typhimurium)
2.9
0.248 0.26
2001 1G4Q r(C-A-A-A-G-A-A-A-A-G) d(C-T-T-T-C-T-T-T-G)
1.2
0.143 0.186
2001 1G6U De novo protein, domain swapped dimer
1.5
0.198 0.241
2001 1HTO Glutamine synthase (M. tuberculosis)
2.4
0.227 0.255
2001 1HTQ Glutamine synthase, multicopy model (M. tuberculosis)
2.4
0.204 0.223
2001 1I8F Heptameric archaeal SM protein, (P. aerophilum)
1.8
0.201 0.288
2001 1IJW Invertase Hin + 5'd(TGTTTTTGATAAGA)/ 5'd(ATBro)CTTATAAAAAC)
2.4
0.223 0.251
2001 1IK6 E1b subunit of pyruvate dehydrogenase (P. aerophilum)
2
0.212 0.255
2001 1IKK d(C-C-T-T-T-A-A-A-G-G)
1.6
0.174 0.236
2001 1IKS superoxide dismutase (P. aerophilum)
1.8
0.224 0.259
2001 1JB8 r(CAAAGAAAG) d(GTTTCTTTTC) hybrid
2.4
0.223 0.251
2001 1JBM Sm-like archaeal protein (M. thermautotrophicum)
1.9
0.218 0.255
2001 1JE8 Narl/DNA Complex d(CGTACCCATTAATGGGTACG)
2.12
0.228 0.273
2001 1JG1 Protein carboxymethyltransferase –SAH (P. furiosus)
1.2
0.142 0.198
2001 1JG2 Protein carboxymethyltransferase –ADE (P. furiosus)
1.6
0.217 0.231
2001 1JG3 Protein carboxymethyltransferase –ADE-peptide (P. furiosus)
2.1
0.203 0.227
2001 1JG4 Protein carboxymethyltransferase –SAM (P. furiosus)
1.5
0.21 0.221
2001 1JI7 Crystal Structure Of Tel Sam Polymer (human)
1.45
0.184 0.195
2001 1JJ6 Invertase Hin + 5'd(TGT(Ido)UTTTGATAAGA) 5'd(ATCTTATCAAAAAC)
2.3
0.238 0.281
2001 1JJ8 Invertase Hin +5'd(TG(Ido)UTTTTGATAAGA)5'd(ATCTTATCAAAAAC)
2.75
0.213 0.277
2001 1JKO Invertase Hin +5'd(TGTTTTTGGTAAGA) 5'd(ATCTTACCAAAAAC)
2.24
0.244 0.306
2001 1JKP Invertase Hin +5'd(TGTTTTTGAGAAGA) 5'd(ATCTTCTCAAAAAC)
2.8
0.248 0.328
2001 1JKQ Invertase Hin + 5'd(TGTTTTTTATAAGA) 5'd(ATCTTATAAAAAAC)
2.86
0.256 0.328
2001 1JKR Invertase Hin +5'd(TGTTTTTGACAAGA) +5'd(ATCTTGTCAAAAAC)
2.28
0.269 0.325
2001 1JRK Nudix protein (P. aerophilum)
2.4
0.19 0.275
2001 1JS0 RNase A –domain swapped minor trimer (B. Taurus)
2.2
0.184 0.257
2001 1K26 Nudix protein –Iridium (P. aerophilum)
1.85
0.183 0.219
2001 1K2E Nudix protein (P. aerophilum)
1.8
0.184 0.22
2001 1KIB Cytochrome c6 (A. maxima)
3.5
0.204 0.223
2000 1DC0 d(C-A-T-G-G-G-C-C-C-A-T-G)
1.3
0.172 0.2
2000 1EN3 d(C-C-A-A-C-G-T-T-G-C)
1
0.141 0.159
2000 1EN8 d(C-C-A-A-C-G-T-T-G-G)
1.3
0.117 0.139
2000 1EN9 d(C-C-A-G-C-G-C-T-G-G)
1
0.138 0.151
2000 1ENE d(C-C-A-G-C-G-C-T-G-G)
1
0.121 0.148
2000 1EWF Bactericidal/permeability-increasing protein
1.7
0.198 0.25
2000 1F0L Diptheria toxin
1.6
0.188 0.231
2000 1F0M Ephb2 Sam domain
2.2
0.243 0.264
2000 1F0N Antigen 85B, (M. tuberculosis)
1.8
0.19 0.264
2000 1F0P Antigen 85B, trehalose (M. tuberculosis)
1.9
0.195 0.284
2000 1F0V Rnase A major dimer (bovine)
1.8
0.184 0.213
2000 1F0X D-Lactate Dehydrogenase
1.9
0.209 0.248
1999 1DOF Adenylosuccinate lyase, (P. aerophilum)
2.1
0.203 0.245
1999 1C3U Adenylosuccinate lyase, (T. maritima)
2.3
0.199 0.23
1999 1C3C Adenylosuccinate lyase, (T. maritima)
1.8
0.179 0.207
1999 1DC0 5’-d(C-A-T-G-G-G-C-C-C-A-T-G)
1.3
0.172 0.19
1999 455D A6/A18 inter-strand dithiobis(propane)-crosslinked (cgcgaattcgcg)
1.4
0.208 0.276
1998 3HIP High Potential Iron-Sulfur Protein (C. purpuratum)
2.8
0.244 0.288
1998 1A2W RNase domain swapped dimer
2.1
0.192 0.256
1998 1BYZ Designed peptide alpha-1
0.9
0.085 0.105
1998 3AL1 Designed peptide alpha-1, racemic
0.8
0.131 0.145
1998 1B4F Ephb2 receptor sam domain
1.9
0.228 0.273
1998 2JCW Cu,Zn Superoxide Dismutase (reduced broken bridge) 25 °C
1.7
0.191
1998 1B4L Cu,Zn Superoxide dismutase, oxygen
1.8
0.2 0.254
1998 1B4T Cu,Zn Superoxide dismutase, H48C
1.8
0.209 0.258
1998 1YAZ Cu,Zn Superoxide dismutase, azide bound
1.7
0.173 0.208
1998 1YAC Ycac gene product
1.8
0.218 0.235
1997 307D Primer for HIV-1 second strand synthesis
1.8
0.233
1997 334D C-A-T-G-G-C-C-A-T-G + Lexitropsin
1.8
0.2
1997 1BP1 BPI, Human bactericidal permeability-increasing protein
2.4
0.225 0.295
1997 1AZV Cu,Zn Superoxide dismutase, familial, A1s Mutant G37R
1.9
0.202 0.244
1996 1RNL Nitrate-nitrite response regulator
2.4
0.207 0.251
1996 1TGH Human TBP with TATA element DNA
2.9
0.214 0.294
1996 1COI ValD (Designed Trimeric Coiled Coil)
2.1
0.214 0.285
1996 1JER Cucumber stellacyanin, Cu+2 pH 7.0
1.6
0.195 0.237
1996 1SGK Diphtheria toxin, dimeric nucleotide free
2.3
0.182 0.282
1995 2ERL Er-1 pheromone
1
0.135 0.165
1995 1TOX Diphtheria toxin , dimeric with NAD
2.3
0.227 0.307
1995 1YSO Yeast superoxide dismutase
1.7
0.182
1995 1JCV Cu,Zn superoxide dismutase (reduced broken bridge) –180 °C
1.5
0.19 0.229
1995 1JCW Cu,Zn Superoxide Dismutase (reduced broken bridge) 25 °C
1.7
0.191
1995 1CYI Cytochrome c6, Form I
1.9
0.194
1995 1CYJ Cytochrome c6, Form II
2
0.185
1995 1LEX C-G-C-G-A-A-T-T-C-G-C-G+ Lexitropsin (Orientation 1)
2.2
0.165 0.248
1995 1LEY C-G-C-G-A-A-T-T-C-G-C-G+ Lexitropsin (Orientation 2)
2.2
0.164 0.235
1994 1LGR Glutamine synthetase complexed with AMP
2.8
0.233
1994 2LGS Glutamine synthetase complexed with glutamate
2.8
0.235
1994 167D C-C-A-T-T-A-A-T-G-C (trigonal)
2.3
0.2
1994 158D C-C-A-A-G-C-T-T-G-G (hexagonal)
1.9
0.181
1994 274D C-C-A-A-C-G-T-T-G-G + Anthramycin
2.3
0.212
1994 101D C-G-C-G-A-A-T-T-5brC-G-C-G + Netropsin, re-refinement
2.2
0.163 0.252
1994 196D C-T-C-T-C-G-A-G-A-G (monoclinic)
1.7
0.183
1994 1MDT Diphtheria toxin (monomer)
2.3
0.207
1994 1DDT Diphtheria toxin (dimer)
2
0.195
1994 1DTP Diphtheria toxin catalytic domain (residues 1-190) (APUP)
2.5
0.197
1993 126D C-A-T-G-G-C-C-A-T-G (orthorhombic)
2
0.196
1993 1HCR Hin recombinase (DNA-binding domain) + DNA 13-mer
2.3
0.228
1993 1COS Coiled serine (Antiparallel triple coiled-coil)
2.1
0.18
1993 1BGC Granulocyte colony-stimulating factor (RBG-CSF)
1.7
0.213
1993 1BGD Granulocyte colony-stimulating factor (Form I, RCG-CSFI)
2.3
0.207
1993 1BGE Granulocyte colony-stimulating factor (Form II, RCG-CSFII)
2.2
0.193
1993 1RHG Granulocyte-colony stimulating factor (R-HU-GCSF)
2.2
0.215
1993 2PLT Plastocyanin
1.5
0.168
1993 1RLD Ribulose-1,5-bisphosphate carboxylase/oxygenase
2.5
0.211
1993 1RLC Ribulose-1,5-bisphosphate carboxylase/oxygenase + CABP
2.7
0.196
1992 1D62 C-C-A-A-I-A-T-T-G-G
2
0.134
1992 1D61 C-C-A-A-C-I-T-T-G-G (monoclinic, Ca2+)
1.3
0.152
1992 1D56 C-G-A-T-A-T-A-T-C-G (orthorhombic, Ca2+)
1.7
0.178
1992 1D57 C-G-A-T-A-T-A-T-C-G (orthorhombic, Mg2+)
2
0.165
1992 1D60 C-C-A-A-C-I-T-T-G-G (trigonal, Mg2+)
2.2
0.164
1992 1DA3 C-G-A-T-C-G-6meA-T-C-G (trigonal)
2
0.172
1991 1D49 C-G-A-T-T-A-A-T-C-G (orthorhombic)
1.5
0.157
1991 1D29 C-G-T-G-A-A-T-T-C-A-C-G
2.5
0.158
1991 1D30 C-G-C-G-A-A-T-T-C-G-C-G + DAPI
2.4
0.215
1991 1D46 C-G-C-G-A-A-T-T-C-G-C-G + Hoechst 33258 (-100°C)
2
0.149
1991 1D45 C-G-C-G-A-A-T-T-C-G-C-G + Hoechst 33258 (-25°C)
1.9
0.152
1991 1D43 C-G-C-G-A-A-T-T-C-G-C-G + Hoechst 33258 (piperazine up)
2
0.157
1991 1D44 C-G-C-G-A-A-T-T-C-G-C-G + Hoechst 33258 (piperazine down)
2
0.157
1991 3FIS Fis protein (Factor for Inversion Stimulation)
2.2
0.183
1991 4FIS Mutant Fis protein (R89C)
2.3
0.185
1991 1DFN Defensin HNP-3 (antimicrobial protein)
1.9
0.19
1991 4RCR Photosynthetic reaction center
2.8
0.227
1990 5DNB C-C-A-A-C-G-T-T-C-G (monoclinic)
1.4
0.16
1990 1D23 C-G-A-T-C-G-A-T-C-G (orthorhombic)
1.5
0.161
1990 1AL1 Alpha-1 (Amphiphilic alpha helix)
2.7
0.211
1990 3RUB Ribulose-1,5-bisphosphate carboxylase/oxygenase (Form III)
2
0.194
1990 4RUB Ribulose-1,5-bisphosphate carboxylase/oxygenase (Form IV)
2.7
0.202
1990 2MLT Melittin
2
0.198
1989 2GLS Glutamine synthetase
3.5
0.258
HomeDOE-MBI HomePeopleSeminarsLecturesWebmail