| Year | PDB | Name | Resolution | Rfactor |
|---|
| | | | Work | FREE |
| 2006 | 2B5O | Ferredoxin-NADP reductase | 2.5 | 0.184 | 0.235 |
| 2006 | 1ZYT | Crystal structure of spin labeled T4 Lysozyme (A82R1) | 1.7 | 0.187 | 0.206 |
| 2006 | 2CUU | Crystal structure of spin labeled T4 Lysozyme (V131R1) | 1.75 | 0.192 | 0.224 |
| 2006 | 2AW9 | Superoxide dismutase with manganese from Deinococcus radiodurans | 2.7 | 0.17 | 0.214 |
| 2006 | 2A4T | Crystal structure of spin labeled T4 Lysozyme (V131R7) | 1.7 | 0.181 | 0.215 |
| 2006 | 1ZR0 | Crystal Structure of Kunitz Domain 1 of Tissue Factor Pathway Inhibitor-2 with Bovine Trypsin ! | 1.8 | 0.231 | 0.296 |
| 2006 | 2DPK | The Crystal Structure of the Primary Ca2+ Sensor of the Na+/Ca2+ Exchanger | 2.5 | 0.225 | 0.284 |
| 2006 | 2GM7 | TenA Homolog/Thi-4 Thiaminase from Pyrobaculum Aerophilum | 2.8 | 0.234 | 0.286 |
| 2006 | 2GM8 | TenA Homolog/Thi-4 Thiaminase complexed with product 4-amino-5-hydroxymethyl-2-methylpyrimidine | 2.5 | 0.189 | 0.237 |
| 2006 | 2G38 | A PE/PPE Protein Complex from Mycobacterium tuberculosis | 2.2 | 0.25 | 0.312 |
| 2006 | 2A7X | Crystal Structure of A Pantothenate synthetase complexed with AMP | 1.7 | 0.15 | 0.175 |
| 2006 | 2A84 | Crystal structure of A Pantothenate synthetase complexed with ATP | 1.55 | 0.152 | 0.169 |
| 2006 | 2A86 | Crystal structure of A Pantothenate synthetase complexed with AMP and beta-alanine | 1.85 | 0.161 | 0.195 |
| 2006 | 2A88 | Crystal structure of A Pantothenate synthetase, apo enzyme in C2 space group | 1.7 | 0.155 | 0.186 |
| 2006 | 2B5A | C.BclI, Control Element of the BclI Restriction-Modification System | 1.54 | 0.167 | 0.2 |
| 2006 | 2FGY | Beta Carbonic Anhydrase from the Carboxysomal Shell of Halothiobacillus neapolitanus (CsoSCA) | 2.2 | 0.171 | 0.217 |
| 2005 | 2APQ | Crystal Structure of an Active Site Mutant of Bovine Pancreatic Ribonuclease A (H119A-RNase A) with a 10-Glutamine expansion in the C-terminal hinge-loop. | 1.8 | 0.181 | 0.215 |
| 2005 | 2A18 | Carboxysome shell protein ccmK4, crystal form 2 | 2.28 | 0.204 | 0.222 |
| 2005 | 2A1B | Carboxysome shell protein ccmK2 | 2.9 | 0.313 | 0.346 |
| 2005 | 2A5X | Crystal Structure of a Cross-linked Actin Dimer | 2.49 | 0.197 | 0.25 |
| 2005 | 1NBU | 7,8-Dihydroneopterin Aldolase Complexed with Product From Mycobacterium Tuberculosis | 1.6 | 0.162 | 0.217 |
| 2005 | 1P7G | superoxide dismutase from Pyrobaculum aerophilum | | | |
| 2005 | 1Y67 | Crystal Structure of Manganese Superoxide Dismutase from Deinococcus radiodurans | 1.85 | 0.184 | 0.205 |
| 2005 | 1YJO | NNQQNY peptide from yeast prion Sup35 w/ Zn | 1.3 | 0.11 | 0.154 |
| 2005 | 1YJP | GNNQQNY peptide from yeast prion Sup35 | 1.8 | 0.181 | 0.19 |
| 2005 | 1YKW | Novel RuBisCO-Like Protein from C. tepidum | 2 | 0.201 | 0.245 |
| 2005 | 1Z8F | Guanylate Kinase Double Mutant A58C, T157C from Mycobacterium tuberculosis (Rv1389) | 2.5 | 0.181 | 0.236 |
| 2005 | 1Z9W | Tetrameric structure of apo-7,8-Dihydroneopterin Aldolase from Mycobacterium tuberculosis | 2.5 | 0.179 | 0.234 |
| 2005 | 1ZD1 | NarLc withNULL74/-65 nonpalindromic promoter DNA | 2.3 | 0.256 | 0.286 |
| 2005 | 1ZG5 | NarLc withNULL89/-89 nonpalindromic promoter DNA | 2.3 | 0.217 | 0.252 |
| 2005 | 1Z6K | Citrate lyase beta subunit complexed with oxaloacetate and magnesium from M. tuberculosis | 2.3 | 0.224 | 0.256 |
| 2004 | 1S3Q | Ferritin with iron and magnesium (A. fulgidis) | 2.1 | 0.18 | 0.24 |
| 2004 | 1S3Q | Novel open pore ferritin APO form ( A.fulgidus) | 2.1 | 0.179 | 0.217 |
| 2004 | 1S4Q | guanylate kinase (M. tuberculosis) | 2.16 | 0.177 | 0.231 |
| 2004 | 1S51 | Bacteriorhodopsin mutant T24S | 2 | 0.212 | 0.272 |
| 2004 | 1S52 | Bacteriorhodopsin mutant T24V | 2.3 | 0.199 | 0.266 |
| 2004 | 1S53 | Bacteriorhodopsin mutant T46S | 2 | 0.214 | 0.266 |
| 2004 | 1S54 | Bacteriorhodopsin mutant T24A | 2.2 | 0.231 | 0.287 |
| 2004 | 1S71 | TruB (M. tuberculosis) | 1.9 | 0.2 | 0.24 |
| 2004 | 1SGV | tRNA PseudoUridine Synthase (M.Tuberculosis) | 1.9 | 0.201 | 0.239 |
| 2004 | 1SIX | dUTPase (Rv2697c) +dUMPNPP+ Mg2+ (M. tuberculosis) | 1.3 | 0.12 | 0.138 |
| 2004 | 1SJN | dUTPase (Rv2697c) +dUMPNPP+ Mg2+ (M. tuberculosis) | 1.8 | 0.168 | 0.198 |
| 2004 | 1SK5 | Ultra-high resolution structure d(CTTTTAAAAG) | 0.89 | 0.126 | 0.145 |
| 2004 | 1SLH | dUTPase (Rv2697c) +dUDP+ Mg2+ (M. tuberculosis) | 3 | 0.224 | 0.265 |
| 2004 | 1SM8 | dUTPase (Rv2697c) +dUTP + Cr3+(M. tuberculosis) | 2.9 | 0.235 | 0.282 |
| 2004 | 1SMC | dUTPase (Rv2697c) +dUTP (M. tuberculosis) | 2.05 | 0.166 | 0.207 |
| 2004 | 1SNF | dUTPase (Rv2697c) + dUMP + Mg2+ (M. tuberculosis) | 1.85 | 0.169 | 0.204 |
| 2004 | 1SQ3 | Novel open pore ferritin Fe form ( A.fulgidus) | 2.7 | 0.177 | 0.217 |
| 2004 | 1SV0 | Yan-SAM + Mae-SAM complex (D. melanogaster) | 2.07 | 0.232 | 0.255 |
| 2004 | 1SV4 | Yan-SAM domain (D. melanogaster) | 2.15 | 0.22 | 0.251 |
| 2004 | 1SVD | RuBisCO (Halothiobacillus neapolitanus) | 1.8 | 0.146 | 0.168 |
| 2004 | 1TN0 | Bacterorhodopsin A51P | 2.5 | 0.173 | 0.262 |
| 2004 | 1TN5 | Bacterorhodopsin K41P | 2.2 | 0.249 | 0.299 |
| 2004 | 1U5H | Citrate Lyase Beta Subunit ( M.Tuberculosis) | 1.65 | 0.267 | 0.272 |
| 2004 | 1U5V | Citrate Lyase Beta Subunit +ATP ( M.Tuberculosis) | 1.85 | 0.212 | 0.234 |
| 2004 | 1XJI | Bacteriorhodopsin crystallized in bicelles at room temperature | 2.2 | 0.226 | 0.256 |
| 2003 | 1N2B | Pantothenate synthetase –AMPCPP pantoate (M. tuberculosis) | 1.7 | 0.184 | 0.215 |
| 2003 | 1N2I | Pantothenate synthetase –pantoyl adenylate (M. tuberculosis) soaked | 1.7 | 0.182 | 0.204 |
| 2003 | 1N2O | Pantothenate synthetase –beta alanine (M. tuberculosis) | 2.1 | 0.202 | 0.237 |
| 2003 | 1OY0 | Ketopantoate Hydroxymethyltransferase | 2.8 | 0.237 | 0.277 |
| 2003 | 1PJG | r(CAAAGAAAAG) d(GTTTCTTTTC), Ca2+ | 1.1 | 0.127 | 0.158 |
| 2003 | 1PJO | r(CAAAGAAAAG) d(GTTTCTTTTC), Mg2+ | 1.2 | 0.117 | 0.156 |
| 2003 | 1PK1 | Hetero SAM domain structure of Ph and Scm | 1.8 | 0.233 | 0.249 |
| 2003 | 1PK3 | Scm SAM domain | 1.85 | 0.216 | 0.231 |
| 2003 | 1PXR | Structure of Pro50Ala mutant of Bacteriorhodopsin | 1.7 | 0.207 | 0.245 |
| 2003 | 1PXS | Structure of Met56Ala mutant of Bacteriorhodopsin | 2.2 | 0.198 | 0.251 |
| 2003 | 1PY6 | Bacteriorhodopsin crystallized from bicells | 1.8 | 0.21 | 0.249 |
| 2003 | 1Q5I | Bacteriorhodopsin mutant P186A | 2.3 | 0.194 | 0.255 |
| 2003 | 1Q5J | Bacteriorhodopsin mutant P91A | 2.1 | 0.216 | 0.267 |
| 2003 | 1R7K | FolB tetrameric (Rv3607c) (M. tuberculosis) | 2.5 | 0.273 | 0.295 |
| 2003 | 1RH6 | Xis insertion factor DNA comple | 1.7 | 0.191 | 0.226 |
| 2003 | 1RII | Phosphoglycerate mutase (Rv0489) (M. tuberculosis) | 1.7 | 0.205 | 0.257 |
| 2003 | 1RKI | Pag5_736 | 1.6 | 0.18 | 0.24 |
| 2002 | 1KME | Bacteriorhodopsin Crystallized From Bicelles (H. salinarum) | 2 | 0.263 | 0.275 |
| 2002 | 1KW4 | Polyhomeotic Sam Domain Structure (D. melanogater) | 1.75 | 0.22 | 0.234 |
| 2002 | 1L5X | Survival protein E (SurE) homolog (P. aerophilum) | 2 | 0.185 | 0.223 |
| 2002 | 1L6P | Disulfide interchange protein, DsbD, N-termal domain (E. coli) | 1.65 | 0.138 | 0.215 |
| 2002 | 1L9L | Granulysin (human) | 0.92 | 0.137 | 0.188 |
| 2002 | 1LKY | Structure Of The Wild-Type Tel-Sam Polymer | 2.3 | 0.232 | 0.283 |
| 2002 | 1LMI | Secreted protein, Mpt63, Rv1926c (M. tuberculosis) | 1.5 | 0.197 | 0.252 |
| 2002 | 1LNX | SmAP1 heptamer in a new crystal form (P. aerophilum) | 2.05 | 0.182 | 0.226 |
| 2002 | 1LOJ | SmAP + uridine-5'-monophosphate (M. thermautotrophicum) | 1.9 | 0.207 | 0.25 |
| 2002 | 1LU4 | Disulfide oxido reductase, DsbE (M. tuberculosis) Rv2878c | 1.1 | 0.143 | 0.203 |
| 2002 | 1M5Q | SmAP (P. aerophilum) | 2 | 0.191 | 0.236 |
| 2002 | 1M98 | Crystal Structure Of Orange Carotenoid Protein (A. maxima) | 2.1 | 0.218 | 0.275 |
| 2002 | 1MOP | Pantothenate synthetase (M. tuberculosis) | 1.6 | 0.192 | 0.211 |
| 2002 | 1MQ7 | dUTPase (M. tuberculosis) | 1.95 | 0.197 | 0.226 |
| 2002 | 1MY6 | Fe-Superoxide dismutase (T. elongatus) | 1.6 | 0.189 | 0.226 |
| 2002 | 1MZ4 | Cytochrome c550 (T. elongatus) | 1.8 | 0.182 | 0.202 |
| 2002 | 1N2E | Pantothenate synthetase –AMPCPP pantoate (M. tuberculosis) | 1.6 | 0.188 | 0.21 |
| 2002 | 1N2G | Pantothenate synthetaseNULLAMPCPP (M. tuberculosis) | 1.8 | 0.192 | 0.223 |
| 2002 | 1N2H | Pantothenate synthetase –pantoyl adenylate (M. tuberculosis) cocrystallized | 2 | 0.182 | 0.218 |
| 2002 | 1N2J | Pantothenate synthetaseNULLpantoate (M. tuberculosis) | 1.8 | 0.193 | 0.225 |
| 2001 | 1F18 | Cu,Zn Superoxide dismutase, G85R mutant | 1.8 | 0.197 | 0.234 |
| 2001 | 1F1A | Cu,Zn Superoxide dismutase, H48Q mutant | 1.8 | 0.2 | 0.239 |
| 2001 | 1F1C | Cytochrome c549 (A. maxima) | 2.3 | 0.217 | 0.26 |
| 2001 | 1F1D | Cu,Zn Superoxide dismutase, H46C mutant | 1.8 | 0.2 | |
| 2001 | 1F1E | Histone (M. kandleri) | 1.3 | 0.163 | 0.208 |
| 2001 | 1F1F | Cytochrome c6 (A. maxima) | 2.3 | 0.232 | 0.255 |
| 2001 | 1F1G | Cu,Zn Superoxide dismutase, nitric oxide | 1.8 | 0.171 | |
| 2001 | 1F1H | Glutamine synthetase-ADP-thallium (S. typhimurium) | 2.7 | 0.233 | 0.264 |
| 2001 | 1F1O | Adenylosuccinate lyase (B. subtilis) | 3.3 | 0.336 | 0.355 |
| 2001 | 1F52 | Glutamine synthetase (S. typhimurium) | 2.5 | 0.243 | 0.252 |
| 2001 | 1FK0 | Maize lipid-transfer protein complex with capric acid | 1.8 | 0.214 | 0.241 |
| 2001 | 1FK1 | Maize lipid-transfer protein complex with lauric acid | 1.8 | 0.182 | 0.194 |
| 2001 | 1FK2 | Maize lipid-transfer protein complex with myristic acid | 1.8 | 0.191 | 0.197 |
| 2001 | 1FK3 | Maize lipid-transfer protein complex with palmitoleic acid | 1.8 | 0.2 | 0.236 |
| 2001 | 1FK4 | Maize lipid-transfer protein complex with stearic acid | 1.8 | 0.208 | 0.2 |
| 2001 | 1FK5 | Maize lipid-transfer protein complex with oleic acid | 1.3 | 0.135 | 0.188 |
| 2001 | 1FK6 | Maize lipid-transfer protein complex with a-linolenic acid | 1.9 | 0.207 | 0.274 |
| 2001 | 1FK7 | Maize lipid-transfer protein complex with ricinoleic acid | 1.9 | 0.205 | 0.274 |
| 2001 | 1FPY | Glutamine synthetase-ADP-phosphinothricin (S. typhimurium) | 2.9 | 0.248 | 0.26 |
| 2001 | 1G4Q | r(C-A-A-A-G-A-A-A-A-G) d(C-T-T-T-C-T-T-T-G) | 1.2 | 0.143 | 0.186 |
| 2001 | 1G6U | De novo protein, domain swapped dimer | 1.5 | 0.198 | 0.241 |
| 2001 | 1HTO | Glutamine synthase (M. tuberculosis) | 2.4 | 0.227 | 0.255 |
| 2001 | 1HTQ | Glutamine synthase, multicopy model (M. tuberculosis) | 2.4 | 0.204 | 0.223 |
| 2001 | 1I8F | Heptameric archaeal SM protein, (P. aerophilum) | 1.8 | 0.201 | 0.288 |
| 2001 | 1IJW | Invertase Hin + 5'd(TGTTTTTGATAAGA)/ 5'd(ATBro)CTTATAAAAAC) | 2.4 | 0.223 | 0.251 |
| 2001 | 1IK6 | E1b subunit of pyruvate dehydrogenase (P. aerophilum) | 2 | 0.212 | 0.255 |
| 2001 | 1IKK | d(C-C-T-T-T-A-A-A-G-G) | 1.6 | 0.174 | 0.236 |
| 2001 | 1IKS | superoxide dismutase (P. aerophilum) | 1.8 | 0.224 | 0.259 |
| 2001 | 1JB8 | r(CAAAGAAAG) d(GTTTCTTTTC) hybrid | 2.4 | 0.223 | 0.251 |
| 2001 | 1JBM | Sm-like archaeal protein (M. thermautotrophicum) | 1.9 | 0.218 | 0.255 |
| 2001 | 1JE8 | Narl/DNA Complex d(CGTACCCATTAATGGGTACG) | 2.12 | 0.228 | 0.273 |
| 2001 | 1JG1 | Protein carboxymethyltransferase –SAH (P. furiosus) | 1.2 | 0.142 | 0.198 |
| 2001 | 1JG2 | Protein carboxymethyltransferase –ADE (P. furiosus) | 1.6 | 0.217 | 0.231 |
| 2001 | 1JG3 | Protein carboxymethyltransferase –ADE-peptide (P. furiosus) | 2.1 | 0.203 | 0.227 |
| 2001 | 1JG4 | Protein carboxymethyltransferase –SAM (P. furiosus) | 1.5 | 0.21 | 0.221 |
| 2001 | 1JI7 | Crystal Structure Of Tel Sam Polymer (human) | 1.45 | 0.184 | 0.195 |
| 2001 | 1JJ6 | Invertase Hin + 5'd(TGT(Ido)UTTTGATAAGA) 5'd(ATCTTATCAAAAAC) | 2.3 | 0.238 | 0.281 |
| 2001 | 1JJ8 | Invertase Hin +5'd(TG(Ido)UTTTTGATAAGA)5'd(ATCTTATCAAAAAC) | 2.75 | 0.213 | 0.277 |
| 2001 | 1JKO | Invertase Hin +5'd(TGTTTTTGGTAAGA) 5'd(ATCTTACCAAAAAC) | 2.24 | 0.244 | 0.306 |
| 2001 | 1JKP | Invertase Hin +5'd(TGTTTTTGAGAAGA) 5'd(ATCTTCTCAAAAAC) | 2.8 | 0.248 | 0.328 |
| 2001 | 1JKQ | Invertase Hin + 5'd(TGTTTTTTATAAGA) 5'd(ATCTTATAAAAAAC) | 2.86 | 0.256 | 0.328 |
| 2001 | 1JKR | Invertase Hin +5'd(TGTTTTTGACAAGA) +5'd(ATCTTGTCAAAAAC) | 2.28 | 0.269 | 0.325 |
| 2001 | 1JRK | Nudix protein (P. aerophilum) | 2.4 | 0.19 | 0.275 |
| 2001 | 1JS0 | RNase A –domain swapped minor trimer (B. Taurus) | 2.2 | 0.184 | 0.257 |
| 2001 | 1K26 | Nudix protein –Iridium (P. aerophilum) | 1.85 | 0.183 | 0.219 |
| 2001 | 1K2E | Nudix protein (P. aerophilum) | 1.8 | 0.184 | 0.22 |
| 2001 | 1KIB | Cytochrome c6 (A. maxima) | 3.5 | 0.204 | 0.223 |
| 2000 | 1DC0 | d(C-A-T-G-G-G-C-C-C-A-T-G) | 1.3 | 0.172 | 0.2 |
| 2000 | 1EN3 | d(C-C-A-A-C-G-T-T-G-C) | 1 | 0.141 | 0.159 |
| 2000 | 1EN8 | d(C-C-A-A-C-G-T-T-G-G) | 1.3 | 0.117 | 0.139 |
| 2000 | 1EN9 | d(C-C-A-G-C-G-C-T-G-G) | 1 | 0.138 | 0.151 |
| 2000 | 1ENE | d(C-C-A-G-C-G-C-T-G-G) | 1 | 0.121 | 0.148 |
| 2000 | 1EWF | Bactericidal/permeability-increasing protein | 1.7 | 0.198 | 0.25 |
| 2000 | 1F0L | Diptheria toxin | 1.6 | 0.188 | 0.231 |
| 2000 | 1F0M | Ephb2 Sam domain | 2.2 | 0.243 | 0.264 |
| 2000 | 1F0N | Antigen 85B, (M. tuberculosis) | 1.8 | 0.19 | 0.264 |
| 2000 | 1F0P | Antigen 85B, trehalose (M. tuberculosis) | 1.9 | 0.195 | 0.284 |
| 2000 | 1F0V | Rnase A major dimer (bovine) | 1.8 | 0.184 | 0.213 |
| 2000 | 1F0X | D-Lactate Dehydrogenase | 1.9 | 0.209 | 0.248 |
| 1999 | 1DOF | Adenylosuccinate lyase, (P. aerophilum) | 2.1 | 0.203 | 0.245 |
| 1999 | 1C3U | Adenylosuccinate lyase, (T. maritima) | 2.3 | 0.199 | 0.23 |
| 1999 | 1C3C | Adenylosuccinate lyase, (T. maritima) | 1.8 | 0.179 | 0.207 |
| 1999 | 1DC0 | 5’-d(C-A-T-G-G-G-C-C-C-A-T-G) | 1.3 | 0.172 | 0.19 |
| 1999 | 455D | A6/A18 inter-strand dithiobis(propane)-crosslinked (cgcgaattcgcg) | 1.4 | 0.208 | 0.276 |
| 1998 | 3HIP | High Potential Iron-Sulfur Protein (C. purpuratum) | 2.8 | 0.244 | 0.288 |
| 1998 | 1A2W | RNase domain swapped dimer | 2.1 | 0.192 | 0.256 |
| 1998 | 1BYZ | Designed peptide alpha-1 | 0.9 | 0.085 | 0.105 |
| 1998 | 3AL1 | Designed peptide alpha-1, racemic | 0.8 | 0.131 | 0.145 |
| 1998 | 1B4F | Ephb2 receptor sam domain | 1.9 | 0.228 | 0.273 |
| 1998 | 2JCW | Cu,Zn Superoxide Dismutase (reduced broken bridge) 25 °C | 1.7 | 0.191 | |
| 1998 | 1B4L | Cu,Zn Superoxide dismutase, oxygen | 1.8 | 0.2 | 0.254 |
| 1998 | 1B4T | Cu,Zn Superoxide dismutase, H48C | 1.8 | 0.209 | 0.258 |
| 1998 | 1YAZ | Cu,Zn Superoxide dismutase, azide bound | 1.7 | 0.173 | 0.208 |
| 1998 | 1YAC | Ycac gene product | 1.8 | 0.218 | 0.235 |
| 1997 | 307D | Primer for HIV-1 second strand synthesis | 1.8 | 0.233 | |
| 1997 | 334D | C-A-T-G-G-C-C-A-T-G + Lexitropsin | 1.8 | 0.2 | |
| 1997 | 1BP1 | BPI, Human bactericidal permeability-increasing protein | 2.4 | 0.225 | 0.295 |
| 1997 | 1AZV | Cu,Zn Superoxide dismutase, familial, A1s Mutant G37R | 1.9 | 0.202 | 0.244 |
| 1996 | 1RNL | Nitrate-nitrite response regulator | 2.4 | 0.207 | 0.251 |
| 1996 | 1TGH | Human TBP with TATA element DNA | 2.9 | 0.214 | 0.294 |
| 1996 | 1COI | ValD (Designed Trimeric Coiled Coil) | 2.1 | 0.214 | 0.285 |
| 1996 | 1JER | Cucumber stellacyanin, Cu+2 pH 7.0 | 1.6 | 0.195 | 0.237 |
| 1996 | 1SGK | Diphtheria toxin, dimeric nucleotide free | 2.3 | 0.182 | 0.282 |
| 1995 | 2ERL | Er-1 pheromone | 1 | 0.135 | 0.165 |
| 1995 | 1TOX | Diphtheria toxin , dimeric with NAD | 2.3 | 0.227 | 0.307 |
| 1995 | 1YSO | Yeast superoxide dismutase | 1.7 | 0.182 | |
| 1995 | 1JCV | Cu,Zn superoxide dismutase (reduced broken bridge) –180 °C | 1.5 | 0.19 | 0.229 |
| 1995 | 1JCW | Cu,Zn Superoxide Dismutase (reduced broken bridge) 25 °C | 1.7 | 0.191 | |
| 1995 | 1CYI | Cytochrome c6, Form I | 1.9 | 0.194 | |
| 1995 | 1CYJ | Cytochrome c6, Form II | 2 | 0.185 | |
| 1995 | 1LEX | C-G-C-G-A-A-T-T-C-G-C-G+ Lexitropsin (Orientation 1) | 2.2 | 0.165 | 0.248 |
| 1995 | 1LEY | C-G-C-G-A-A-T-T-C-G-C-G+ Lexitropsin (Orientation 2) | 2.2 | 0.164 | 0.235 |
| 1994 | 1LGR | Glutamine synthetase complexed with AMP | 2.8 | 0.233 | |
| 1994 | 2LGS | Glutamine synthetase complexed with glutamate | 2.8 | 0.235 | |
| 1994 | 167D | C-C-A-T-T-A-A-T-G-C (trigonal) | 2.3 | 0.2 | |
| 1994 | 158D | C-C-A-A-G-C-T-T-G-G (hexagonal) | 1.9 | 0.181 | |
| 1994 | 274D | C-C-A-A-C-G-T-T-G-G + Anthramycin | 2.3 | 0.212 | |
| 1994 | 101D | C-G-C-G-A-A-T-T-5brC-G-C-G + Netropsin, re-refinement | 2.2 | 0.163 | 0.252 |
| 1994 | 196D | C-T-C-T-C-G-A-G-A-G (monoclinic) | 1.7 | 0.183 | |
| 1994 | 1MDT | Diphtheria toxin (monomer) | 2.3 | 0.207 | |
| 1994 | 1DDT | Diphtheria toxin (dimer) | 2 | 0.195 | |
| 1994 | 1DTP | Diphtheria toxin catalytic domain (residues 1-190) (APUP) | 2.5 | 0.197 | |
| 1993 | 126D | C-A-T-G-G-C-C-A-T-G (orthorhombic) | 2 | 0.196 | |
| 1993 | 1HCR | Hin recombinase (DNA-binding domain) + DNA 13-mer | 2.3 | 0.228 | |
| 1993 | 1COS | Coiled serine (Antiparallel triple coiled-coil) | 2.1 | 0.18 | |
| 1993 | 1BGC | Granulocyte colony-stimulating factor (RBG-CSF) | 1.7 | 0.213 | |
| 1993 | 1BGD | Granulocyte colony-stimulating factor (Form I, RCG-CSFI) | 2.3 | 0.207 | |
| 1993 | 1BGE | Granulocyte colony-stimulating factor (Form II, RCG-CSFII) | 2.2 | 0.193 | |
| 1993 | 1RHG | Granulocyte-colony stimulating factor (R-HU-GCSF) | 2.2 | 0.215 | |
| 1993 | 2PLT | Plastocyanin | 1.5 | 0.168 | |
| 1993 | 1RLD | Ribulose-1,5-bisphosphate carboxylase/oxygenase | 2.5 | 0.211 | |
| 1993 | 1RLC | Ribulose-1,5-bisphosphate carboxylase/oxygenase + CABP | 2.7 | 0.196 | |
| 1992 | 1D62 | C-C-A-A-I-A-T-T-G-G | 2 | 0.134 | |
| 1992 | 1D61 | C-C-A-A-C-I-T-T-G-G (monoclinic, Ca2+) | 1.3 | 0.152 | |
| 1992 | 1D56 | C-G-A-T-A-T-A-T-C-G (orthorhombic, Ca2+) | 1.7 | 0.178 | |
| 1992 | 1D57 | C-G-A-T-A-T-A-T-C-G (orthorhombic, Mg2+) | 2 | 0.165 | |
| 1992 | 1D60 | C-C-A-A-C-I-T-T-G-G (trigonal, Mg2+) | 2.2 | 0.164 | |
| 1992 | 1DA3 | C-G-A-T-C-G-6meA-T-C-G (trigonal) | 2 | 0.172 | |
| 1991 | 1D49 | C-G-A-T-T-A-A-T-C-G (orthorhombic) | 1.5 | 0.157 | |
| 1991 | 1D29 | C-G-T-G-A-A-T-T-C-A-C-G | 2.5 | 0.158 | |
| 1991 | 1D30 | C-G-C-G-A-A-T-T-C-G-C-G + DAPI | 2.4 | 0.215 | |
| 1991 | 1D46 | C-G-C-G-A-A-T-T-C-G-C-G + Hoechst 33258 (-100°C) | 2 | 0.149 | |
| 1991 | 1D45 | C-G-C-G-A-A-T-T-C-G-C-G + Hoechst 33258 (-25°C) | 1.9 | 0.152 | |
| 1991 | 1D43 | C-G-C-G-A-A-T-T-C-G-C-G + Hoechst 33258 (piperazine up) | 2 | 0.157 | |
| 1991 | 1D44 | C-G-C-G-A-A-T-T-C-G-C-G + Hoechst 33258 (piperazine down) | 2 | 0.157 | |
| 1991 | 3FIS | Fis protein (Factor for Inversion Stimulation) | 2.2 | 0.183 | |
| 1991 | 4FIS | Mutant Fis protein (R89C) | 2.3 | 0.185 | |
| 1991 | 1DFN | Defensin HNP-3 (antimicrobial protein) | 1.9 | 0.19 | |
| 1991 | 4RCR | Photosynthetic reaction center | 2.8 | 0.227 | |
| 1990 | 5DNB | C-C-A-A-C-G-T-T-C-G (monoclinic) | 1.4 | 0.16 | |
| 1990 | 1D23 | C-G-A-T-C-G-A-T-C-G (orthorhombic) | 1.5 | 0.161 | |
| 1990 | 1AL1 | Alpha-1 (Amphiphilic alpha helix) | 2.7 | 0.211 | |
| 1990 | 3RUB | Ribulose-1,5-bisphosphate carboxylase/oxygenase (Form III) | 2 | 0.194 | |
| 1990 | 4RUB | Ribulose-1,5-bisphosphate carboxylase/oxygenase (Form IV) | 2.7 | 0.202 | |
| 1990 | 2MLT | Melittin | 2 | 0.198 | |
| 1989 | 2GLS | Glutamine synthetase | 3.5 | 0.258 | |